What is EGFP gene?
Abstract. The enhanced green fluorescent protein (GFP) gene (egfp) was used as a reporter of gene expression driven by the glyceraldehyde-p-dehydrogenase (gpd) gene promoter and the manganese peroxidase isozyme 1 (mnp1) gene promoter in Phanerochaete chrysosporium.
Table of Contents
How large is the GFP?
GFP is a 28 kDa protein that resembles a cylinder with a length of 4.2 nm and a diameter of about 2.4 nm (Hink et al., 2000).
What is the size of the isolated GFPuv plasmid?
Plasmid: pGFPuv
| Source/Vendor: | CLONTECH |
|---|---|
| Size: | 3337 |
| 5′ Sequencing 1 Primer: | lac_promoter |
| 5′ Sequencing 1 Primer Sequence: | CACTTTATGCTTCCGGCTCG |
| Tag 1: | GFPuv |
How do you determine the size of plasmid in gel electrophoresis?
The molecular weight size of unknown plasmids is determined by comparing their band pattern obtained in agarose gel electrophoresis with those obtained with plasmids that have been used as molecular weight or size standards.
Why did you use the linearised plasmid for estimation of the plasmid size?
Different forms of plasmid move with different speed on the gel (see attached figure). So, yes, you should use linearized plasmid to run the gel because the DNA size markers are linear form too.
What is the molecular weight of EGFP?
Product Details
| abID | ab51992 |
|---|---|
| Appearance | Lyophilized protein |
| Physical Form Description | Freeze Dried |
| Molecular Weight | 32.7 kDa |
| Purity by SDS-PAGE | ≥97% |
How do you determine the size of DNA fragments from electrophoresis?
Using electrophoresis, we can see how many different DNA fragments are present in a sample and how large they are relative to one another. We can also determine the absolute size of a piece of DNA by examining it next to a standard “yardstick” made up of DNA fragments of known sizes.
How do you determine the size of DNA?
Start with the Molecular Weight 6.022 x 1023 = Avogadro’s number. Length is the length of your DNA fragment in base pairs. Just multiply by 1000 if you are working in kb. We multiply by 1 x 109 to convert our answer to nanograms.
How do you determine the size of a fragment from a plasmid?
To calculate the fragment size we simply need to subtract the bp difference between the two REs: 5198 bp – 5070 bp = 128 bp. DNA fragment 2 – a large fragment (and our desired DNA fragment as it contains all the features of the plasmid.
How do you determine the size of a plasmid?
You can get an approximate size by cutting it with a restriction enzyme and seeing what size fragments are produced. It might take testing with a few different enzymes to find one that cuts into only a few fragments, so you can add the fragments sizes up to get the total.
Why is EGFP used?
Enhanced GFP (eGFP) was developed for increasing the fluorescence yield and improving its expression in mammalian systems [3]. More recently, many optimized GFP-like fluorescent proteins have been discovered, developed or created, such as the red fluorescent protein TagRFP [4].
How do you determine fragment sizes?
